AGENDA 2030

KOLEJNE DOWODY POTWIERDZAJĄ : TESTY P/C/R NIE WYKRYWAJĄ 🦠 C0¥ID, KTÓREGO NIGDY NIE WYIZOLOWANO

Sekwencje genetyczne stosowane w PCR do wykrywania podejrzanego SARS-CoV-2 oraz do diagnozowania przypadków choroby i śmierci przypisywanej Covid-19 są obecne w dziesiątkach sekwencji samego genomu człowieka oraz w sekwencjach około stu drobnoustrojów. Obejmuje to inicjatory lub startery, najbardziej rozległe fragmenty pobrane losowo z ich rzekomego „genomu”, a nawet tak zwane „geny docelowe”, rzekomo specyficzne dla „nowego koronawirusa”.

Test jest bezwartościowy i wszystkie dotychczas uzyskane “pozytywne” wyniki powinny być naukowo unieważnione i zakomunikowane osobom nim dotkniętym, a w przypadku ich śmierci – ich krewnym. Stephen Bustin, jeden z wiodących światowych ekspertów w dziedzinie PCR, mówi, że w pewnych warunkach każdy może uzyskać wynik pozytywny!

Wspominaliśmy o tym nie raz : nie możesz przeprowadzić określonych testów na wirusa bez znajomości składników wirusa, który próbujesz wykryć. A składniki nie mogą być znane bez uprzedniego wyizolowania/oczyszczenia tego wirusa. Od tego czasu nadal gromadzimy dowody, że nikt nie wyizolował SARS-CoV-2.

Co ważniejsze, że nie może zostać on nigdy wyizolowany z powodów, które wyjaśniliśmy w zeszłym miesiącu (przeczytajcie raport “Can you prove that there are pathogenic viruses?” na naszej stronie internetowej -www.dsalud.com). A w niniejszym raporcie przedstawimy nowe dane, z których wynika, że RT-PCR nie wykrywa tzw. SARS-CoV-2, jak wiadomo, ale fragmenty ludzkiego RNA i fragmenty licznych mikrobów.

Wyjaśniliśmy już liczne problemy, jakie stwarza RT-PCR, uznane przez organizacje lub rządy, takie jak WHO lub CDC oraz przez prestiżowych międzynarodowych ekspertów, takich jak dr Stephen Bustin, który uważa zarówno arbitralność ustanawiania kryteriów dla wyników, jak i wybór liczby cykli za bzdury, ponieważ mogą one prowadzić do tego, że każdy test jest pozytywny.

W tym raporcie zamierzamy załączyć wyniki szczególnego badania, które przeprowadziliśmy na podstawie danych opublikowanych na temat rzekomego SARS-CoV-2 i protokołów zatwierdzonych przez WHO do stosowania RT-PCR, a także danych odpowiadających reszcie „ludzkich koronawirusów”.

A wnioski są niezwykle poważne: żaden z siedmiu „ludzkich koronawirusów” nie został w rzeczywistości wyizolowany, a wszystkie sekwencje starterów ich odpowiednich reakcji PCR, jak również sekwencje dużej liczby fragmentów ich domniemanych genomów, znajdują się w różnych obszarach genomu ludzkiego oraz w genomach bakterii. Wyjaśnimy krok po kroku badania, które doprowadziły nas do tak niezwykłego wniosku.

CZY JAKIEKOLWIEK LUDZKIE KORONAWIRUSY ZOSTAŁY WYIZOLOWANE?

W pierwszej połowie kwietnia, kiedy pierwsze badania, które przeprowadziliśmy wykazały, że SARS-CoV-2 nie został wyizolowany i ponieważ ci, którzy twierdzili, że to zrobili, polegali na “izolatach” poprzednich “ludzkich koronawirusów”, zaczęliśmy robić dokładny przegląd tych zgłoszonych izolatów.

W szczególności dokonaliśmy przeglądu domniemanej pracy izolacyjnej podejrzanych o występowanie ludzkich koronawirusów 229E (rzekomo izolowanych w 1965 roku), OC43 (w 1967 roku), SARS-CoV (w 2003 roku), NL63 (w 2004 roku), HKU1 (w 2005 roku) i MERSCoV (w 2012 roku). I takie są wyniki:

Coronavirus 229E.

Artykuł źródłowy: Dorothy Hamre i John Procknow. A new virus isolated from the human respiratory Tract. Proceedings of the Society for Experimental Biology and Medicine, 121: 1:190-193. January 1, 1966.

Ponieważ autorzy odwołują się do innych artykułów wyjaśniających metodę izolacji – którą nazywają Complement Fixation – skonsultowaliśmy się z referencyjnym artykułem na temat tej metody: artykuł Janet W. Hartley i wsp. Complement Fixation and tissue culture assay for mouse leukaemia viruses PNAS, 53(5):931-938, maj 1965.

Jest to procedura już nieużywana, która wykorzystuje reakcję antygen-przeciwciało do wykrywania jednego lub drugiego. W przypadku, z którym mamy do czynienia, celem było wykrycie antygenów rzekomo nowego wirusa, ale, jak już wyjaśniliśmy, potrzebne są specyficzne przeciwciała, których nie można uzyskać przy pierwszym wykryciu wirusa.

Koronawirus OC43.

Artykuł źródłowy: Paul Lee. Molecular epidemiology of human coronavirus OC43 in Hong Kong. Thesis for the Department of Microbiology, University of Hong Kong, August 2007. The HKU Scholars Hub.

To, co zostało uznane za wirusowe RNA, zostało wyekstrahowane z kultur bez żadnych dowodów na to, że RNA należy do wirusa. Użyte narzędzie – zestaw QIAamp – usuwa odczynniki, inhibitory i zanieczyszczenia, ale nie może określić, skąd pochodzi ekstrahowany RNA. I nie ma żadnej kontroli. Jest ono następnie wzmacniane przez PCR i sekwencjonowane przy założeniu (!), że jest to informacja genetyczna wirusa.

Wreszcie, autor spekuluje na temat mutacji, rekombinacji, genotypów, ewolucji molekularnej, szczepów i innego żargonu, który przekazuje nieudowodnioną ideę, że “wirus” jest przedmiotem pracy.

Koronawirus SARS-CoV.

Artykuł źródłowy: J. S. M. Peiris and others. Coronavirus as a possible cause of SARS. Lancet 361: 1319-25, April 2003.

W artykule nie ma wzmianki o oczyszczeniu. Nie ma nawet wzmianki o filtracji lub wirowaniu. Stwierdzono jedynie, że „wirusy zostały wyizolowane w komórkach wątroby płodu małpy z aspiratów z jamy nosowo-gardłowej i biopsji płuc dwóch pacjentów”. Nie ma żadnych kontroli. Jedyna wzmianka dotyczy „efektu cytopatycznego” przypisywanego wirusowi i że dla znanych wirusów i retrowirusów przeprowadzono PCR bez uzyskania wyników.

Wreszcie, RT-PCR przeprowadzono z „przypadkowymi starterami” i wykryto sekwencję „nieznanego pochodzenia”, w której stwierdzono „słabą homologię z rodziną koronawirusów”. Następnie zaprojektowali startery dla tej sekwencji i podczas testowania 44 próbek od pacjentów z SARS tylko 22 były pozytywne.

Koronawirus NL63.

Artykuł źródłowy: Lia van der Hock and others. Identification of a new human coronavirus. Nature Medicine, 10, 4 April 2004.

Autorzy stwierdzają, że „identyfikacja nieznanych patogenów za pomocą narzędzi biologii molekularnej jest trudna, ponieważ sekwencja docelowa nie jest znana, więc nie można zaprojektować starterów specyficznych dla PCR”.

Użyli narzędzia, które sami opracowali, zwanego VIDISCA, które, jak twierdzą, nie wymaga wcześniejszej znajomości sekwencji! Czy to jest możliwe? Zobaczmy, jak to działa: najpierw przygotowuje się hodowlę i zakłada się, że wirus jest obecny ze względu na dowody na „efekt cytopatyczny”. Nowością wprowadzoną tą metodą jest to, że dodawane są „enzymy restrykcyjne”, enzymy tnące cząsteczki kwasu nukleinowego w określonych miejscach i zawsze o tej samej długości.

W ten sposób, jeśli po działaniu tych enzymów zaobserwują wiele fragmentów DNA lub RNA, które są takie same lub bardzo podobne, wywnioskują, że pochodzi on od wirusa, ponieważ genom gospodarza miałby losowe cięcia, podczas gdy genom wirusa przedstawia duża liczba kopii, które są takie same ze względu na replikację wirusa. I czy taka dedukcja jest prawidłowa? Oczywiście, że nie! To założenie (które jest dodane do poprzedniego założenia, że istnieje wirus) nie bierze pod uwagę, że istnieją “cząsteczki wirusopodobne”, “cząsteczki podobne do retrowirusów”, “endogenne retrowirusy”, “egzosomy”, cząsteczki zewnątrzkomórkowe”, a nawet mitochondrialne DNA.

Negują istnienie niezliczonych cząstek, które posiadają te same cechy reprodukcyjne w dużych ilościach, co “wirusy” i dlatego mogą fałszować wyniki, wytwarzając dużą liczbę identycznych kopii po przecięciu przez enzymy, jak uznano w artykule na temat techniki VIDISCA zatytułowanym Enhanced bioinformatic proSling of VIDISCA libraries for virus detection and Discovery. Została ona opublikowana w tomie 263 badań nad wirusami w dniu 2 kwietnia 2019 r., a jej autorzy – Cormac M. Kinsella i wsp. – uznają, że “nie oczekuje się żadnej redundancji we wkładce VIDISCA z kwasu nukleinowego tła gospodarza, z wyjątkiem przypadku cech “wirusopodobnych”, tj. dużej liczby kopii jak w mitochondrialnym DNA.

Koronawirus HKU1.

Artykuł źródłowy: Patrick C. Y. Woo and others. Characterisation and Complete Genome Sequence of a Novel Coronavirus, Coronavirus HKU1, from Patients with Pneumonia. Journal of Virology, 79, 2, January 2005.

Artykuł, co niewiarygodne, zaczyna się od tych słów: „Pomimo szeroko zakrojonych badań na pacjentach z infekcjami dróg oddechowych, u znacznej części pacjentów nie zidentyfikowano żadnej przyczyny mikrobiologicznej. RNA jest ekstrahowane z
nieoczyszczonych kultur”. Zastosowano też PCR z genami koronawirusów. Do sekwencjonowania wykorzystano dwie bazy danych białek zorganizowane w rodziny, domeny i miejsca funkcjonalne – PFAM i INterProScan- w połączeniu z dwoma programami komputerowymi, które przeprowadzają “przewidywania” dotyczące sposobu łączenia nukleotydów. Tekst dodaje: “Sekwencje te zostały ręcznie zmontowane i zmontowane w celu wytworzenia końcowej sekwencji genomu wirusa”. I po raz kolejny nie ma żadnej kontroli.

Koronawirus MERS-CoV.

Artykuł źródłowy: Ali Moh Zaki and others. Isolation of a Novel Coronavirus from a Man with Pneumonia in Saudi Arabia. The New England Journal of Medicine, 367:19, November 2012. Materiał genetyczny jest ekstrahowany bezpośrednio z supernatantu kultury i próbki plwociny za pomocą narzędzia o nazwie High Puré Viral Nucleic Acid Kit, a następnie testowany różnymi metodami PCR pod kątem różnych znanych mikroorganizmów. Nie ma wzmianki o oczyszczaniu i nie ma kontroli.

Krótko mówiąc, to, co zostało zrobione w przypadku pierwszych koronawirusów – i wielu innych rzekomych wirusów – polega na wyhodowaniu rzekomo zainfekowanych tkanek – każdy „efekt cytopatyczny” przypisywano tylko obecności wirusa – a następnie albo otrzymuje się pewne białka, które bez żadnego testu są uważane za “antygeny wirusa” i kiedy te “antygeny” są wykrywane w hodowlach, jest to interpretowane jako “izolacja”, albo ekstrahuje się fragmenty kwasów nukleinowych zakładając, że należą one do wirusa.

W artykule opublikowanym w poprzednim numerze pisma wyjaśnialiśmy już, że według dr Stefana Lanki tzw. „Efekt cytopatyczny” jest tak naprawdę efektem wywołanym warunkami panującymi w samej kulturze. Zostało to rozpoznane na przykład w artykule Antibiotic-induced release of small extracellular vesicles (exosomes) with surface-associated (Indukowane antybiotykami uwalnianie małych pęcherzyków zewnątrzkomórkowych (egzosomów) z powierzchniowo związanym DNA), opublikowanym 15 sierpnia 2017 r. Na stronie internetowej Nature i podpisanym przez Andrea Németh i innych.

(https://www.ncbi.nlm.nih.gov/…/41598_2017_Article_8392.pdf Tu wyjaśniono, że niektóre substancje – takie jak antybiotyki – dodawane do eksperymentów in vitro mogą obciążać kultury komórkowe, generując nowe sekwencje, które nie zostały wcześniej wykryte. Zostało to już zauważone przez dr Barbarę McClintock w 1983 roku podczas jej wykładu noblowskiego, co można zobaczyć na stronie https://www.nobelprize.org/…/06/mcclintock-lecture.pdf.

W gruncie rzeczy, ŻADEN Z SIEDMIU przypuszczalnych LUDZKICH KORONAWIRUSÓW NAPRAWDĘ NIE BYŁ IZOLOWANY. Jedyne, co się między nimi różniło, to procedury i techniki laboratoryjne, które stawały się coraz bardziej wyrafinowane, co w tym przypadku oznaczało nie większą dokładność, ale większą zdolność do wprowadzania w błąd i samooszukiwania się, co doprowadziło do wirtualnej produkcji SARS-CoV-2.

A oczywistą konsekwencją braku dowodów na jego izolację jest to, że takie „koronawirusy” nie mogą być pociągane do odpowiedzialności za żadną chorobę. Ponadto wszystkie testy – jakiegokolwiek rodzaju – oparte na domniemanych składnikach tych „wirusów” (kwasach nukleinowych lub białkach) są całkowicie dyskwalifikowane jako „testy na zakażenie”, a tym bardziej jako “diagnostyka” chorób.

Więcej zapytań niż odpowiedzi

W poprzednim numerze zebraliśmy już odpowiedzi udzielone przez autorów kilku artykułów, które rzekomo opisywały izolację SARS-CoV-2, w których przyznawali, że nie “oczyszczali”, co w sposób dorozumiany oznacza przyznanie się, że wirus nie został wyizolowany. A teraz dodamy jeszcze jeden dowód: odpowiedzi udzielone przez różne władze – polityczne i zdrowotne – z różnych krajów na temat oczyszczania i izolacji SARS-CoV-2.

James McCumiskey – autor książki The Latest Conspiracy: The Biomedical Paradigm- mówi nam, że National Virus Reference Laboratory of Ireland poprosił o informacje na ten temat z Uniwersytetu w Dublinie, a ten ostatni odpowiedział, że “nie ma żadnych zapisów, które mogłyby dostarczyć odpowiedź na ich wniosek”.

Dyrektor służb prawnych laboratorium nalegał na skierowanie prośby do uniwersytetu, a uniwersytet odpowiedział, że “nie ma dokumentacji, która mogłaby udzielić odpowiedzi na ich prośbę”: “Uniwersytet stoi na stanowisku, że materiał z debaty akademickiej nie może być przedmiotem ustawy o wolności informacji”. Z wniosku NVR wynika, że nie prowadził on hodowli SARS-CoV-2 ani go nie oczyszczał. Potwierdzają jedynie, że „wykryli RNA SARS-CoV-2 w próbkach diagnostycznych”.

W dniu 22 czerwca grupa ekspertów wysłała zapytanie do premiera Wielkiej Brytanii, Borisa Johnsona, o podobnej treści. List podpisali: dr Kevin Corbett, Piers Corbyn – profesor Imperial College London, inżynier i niezależny badacz – z którym przeprowadziliśmy wówczas wywiad w czasopiśmie – David Crowe, dr Andrew Kaufman, edynburski profesor biologii Roger Watson oraz biolog i chemik David Rasnick – i do dziś nie otrzymali odpowiedzi!

Inny podobny wniosek – w tym przypadku do National Research Council of Canada – otrzymał następującą odpowiedź: “Nie byliśmy w stanie przeprowadzić pełnego przeszukania rejestrów NRC, więc z przykrością informujemy, że nie zidentyfikowano żadnych rejestrów, które odpowiadałyby na Państwa prośbę”.

Dodamy, że dwaj dziennikarze wysyłali podobne prośby – na mocy ustawy o wolności informacji – do różnych instytucji w Kanadzie, Nowej Zelandii, Australii, Niemczech, Wielkiej Brytanii i Stanach Zjednoczonych, a do 5 września odpowiedziało na nie dwanaście instytucji (obecnie jest już ponad 40 odpowiedzi), wszystkie wskazując na to samo: że nie mają żadnych zapisów opisujących izolację wirusa, który ma powodować Covid-19.

Szczegóły i odpowiedzi można znaleźć na stronie:
https://www.fluoridefreepeel.ca/u-k-dept-of-health-and…

POCHODZENIE FAŁSZYWEGO GENOMU

Pytanie, które sobie wtedy zadaliśmy, brzmiało: jeśli opublikowane sekwencje nie należą – jak twierdzono – do nowych wirusów, to skąd one pochodzą? Aby spróbować odpowiedzieć na to pytanie, zdecydowaliśmy się na przeprowadzenie wyszukiwania za pomocą programu komputerowego o nazwie Basic Local Alignment Search Tool (BLAST), który pozwala nam na porównanie danej sekwencji ze wszystkimi sekwencjami przechowywanymi w Narodowych Instytutach Zdrowia Stanów Zjednoczonych (jest on publiczny i można go znaleźć na stronie https://blast.ncbi.nlm.nih.gov/Blast.cgi.
Wyjaśniamy krok po kroku, co zrobiliśmy, aby nasi czytelnicy mogli powtórzyć wyszukiwanie i sprawdzić jego wyniki.

Najpierw zebraliśmy wszystkie startery PCR opisane w ówczesnych protokołach umieszczonych na stronie WHO:

  • Chiński protokół CDC: wykorzystuje jako cel geny ORF1ab i N.
  • Protokół Instytutu Pasteura (Francja): używa dwóch fragmentów RdRP (który ma być specyficzny dla SARS.CoV-2).
  • Protokół CDC Stanów Zjednoczonych: wykorzystuje trzy fragmenty genu N.
  • Protokół Narodowego Instytutu Chorób Zakaźnych Japonii: jest jedynym, który ma jako cel gen S wraz z innymi genami rzekomo współdzielonymi z innymi koronaawirusami.
  • Protokół Charite’a (Niemcy): wykorzystuje geny E, N i RdRP.
  • Hong Kong University Protocol: wykorzystuje geny ORF1b-nsp14 i N.
  • Protokół Narodowego Instytutu Zdrowia Tajlandii: wykorzystuje gen N.

Następnie wprowadziliśmy sekwencję starterów – tę, która wskazuje początek sekwencji do wykrycia (w przód) i tę, która wskazuje koniec sekwencji (w tył) – do BLASTa, aby mógł on szukać ich w dwóch bazach danych: kolekcji genomów mikroorganizmów i tej odpowiadającej ludzkiemu genomowi.

SEKWENCJE TZW. SARS-COV-2 ZNAJDUJĄ SIĘ ZARÓWNO U LUDZI, JAK I W LICZNYCH MIKROORGANIZMACH!

Przyjrzyjmy się szczegółowo procedurze na przykładzie inicjatorów protokołu francuskiego. Na stronie BLAST wybraliśmy Mikroby do przeszukania baz danych genomów drobnoustrojów i przeszliśmy na następną stronę. Następnie pojawił się formularz, w którym wpisaliśmy sekwencję startera forward z francuskiego protokołu – czyli ATGAGCTTAGTCCTGTG-, wybraliśmy opcję Bardzo podobne sekwencje i wcisnęliśmy klawisz BLAST. Zaledwie kilka sekund później pojawiły się wyniki – zrobiliśmy zrzut ekranu (zdjęcie 1) – i pokazano nam 100 sekwencji drobnoustrojów – w szczególności bakterii i archeonów – z koincydencją między 77% a 100% z procentem tożsamości 100%.

Następnie wróciliśmy na stronę główną i za drugim razem wybraliśmy Human do przeszukania ludzkiego genomu, powtórzyliśmy tę samą operację i po kilku sekundach pojawił się wynik, który ponownie zarejestrowaliśmy na ekranie (zdjęcie 2). I okazuje się, że wprowadzona sekwencja pokrywa się z 74 sekwencjami ludzkiego genomu, przy czym koincydencja wynosi od 66% do 100%, a procent tożsamości 100%.

A to wskazuje, że sekwencja tego początkowego starteru PCR, który ma być specyficzny dla SARS-CoV-2, odpowiada w rzeczywistości 74 fragmentom ludzkiego genomu i stu fragmentom mikrobiologicznym!

Następnie zdecydowaliśmy się powtórzyć operację, ale z końcowym lub odwrotnym starterem – czyli CTCCCTTTGTGT – i wyniki były podobne.

Ponieważ były to bardzo krótkie sekwencje – około dwudziestu liter genetycznych lub nukleotydów – postanowiliśmy spróbować ponownie, ale z sekwencją docelową zdefiniowaną przez te dwa startery, tj. Sekwencję domniemanego genomu SARS-CoV-2, która znajduje się między początkowym starterem a starterem końcowym. Oczywiście do tego potrzebowaliśmy sekwencji, która jest oficjalnie uważana za „genom SARS-CoV-2” i chociaż tysiące laboratoriów twierdzi, że ją wyizolowało i zsekwencjonowało – fałszywe twierdzenie, jak wyjaśniliśmy w poprzednich raportach – postanowiliśmy wejść na stronę National Center for Biotechnology Information: https://www.ncbi.nlm.nih.gov/nuccore/NC_045512.2….

Tam zlokalizowaliśmy “sekwencję docelową”, fragment 108 nukleotydów znajdujący się pomiędzy pozycjami 12 690 i 12 797 “genomu”, czyli tego:
ATGAGCTTAGTCCTGTTGCACTACGACAGATGTTGTGCCGGTACACAAACTGCTTGCACTGAT GACAATGCGTTAGCTTACAACAACAAAGGGAG.

Powtórzyliśmy w ten sposób opisane wcześniej kroki i wyniki ponownie były zaskakujące, ponieważ ponownie pojawiło się sto sekwencji mikrobów z procentem dopasowania 100% i cztery sekwencje ludzkiego genomu z procentem tożsamości pomiędzy 83% a 95%. Dopasowania były zatem niższe, ale ważne jest, że nadal znajdujemy fragmenty rzekomej “docelowej sekwencji” SARS-CoV-2 zarówno u mikrobów, jak i w naszym własnym genomie.

Naprawdę zdziwieni, zrobiliśmy kolejny krok i przetestowaliśmy z genem uważanym w tamtym czasie za najbardziej specyficzny z SARS-CoV-2, genem E, który ma generować białka otoczki i znajduje się między pozycjami 26.245 a 26.472:

ATGTACTCATTCGTTTCGGAAGAGACAGGTACTACGTTAATAGTTAATAGCGTACTTCTCTTGCTTTCGTGGTATTCTTGCTAGTTACACTAGCCATCCTGCTTCGATTGTGCGTACTGCTGCAATATTGTTAACGTGAGTCTTGTAAAACCTTTACGTTTACTCGTGTTAAAATCTGAATTCTTCTAGAGTTCGATTCTGGTCTAA.

Powtórzyliśmy z nim opisane już kroki, a wynik był tym bardziej zaskakujący, że pomimo jego długości pojawiło się kolejnych sto sekwencji mikrobów z procentem tożsamości 100% i 10 sekwencji ludzkiego genomu z procentem tożsamości pomiędzy 80% a 100%. A podobne wyniki uzyskano z fragmentem wybranym losowo i z genem N, który według nich odpowiada białkom nukleokapsydu SARS-CoV-2.

Ostatecznie zdecydowaliśmy się przetestować gen S, o którym mówi się, że generuje strukturalne białka typu „spike”, które są kluczem do wejścia do komórki i który następnie został uznany za najbardziej specyficzny gen SARS-CoV-2. Ponieważ jest to gen, którego sekwencja jest znacznie dłuższa – 3821 nukleotydów między pozycjami 21 563 i 25 384 – przetestowaliśmy dwa fragmenty wybrane losowo w ramach tego genu, a pierwszy – TTGGCAAAATTCAAGACTCACTTTC – zaowocował kolejnymi setkami sekwencji drobnoustrojów i 93 sekwencjami genomu druga – CTTGCTGCTACTAAATGCAGAGTGT – sto sekwencji drobnoustrojów i 90 genomu ludzkiego.

Ostatecznie zdecydowaliśmy się przetestować z inicjatorami Protokołu Japońskiego, jedynego, który zawiera sekwencje docelowe genu S i, czytelnik już się domyślił, wyniki były jak wcześniej znowu podobnie: sto sekwencji drobnoustrojów i 93 sekwencje ludzkiego genomu z procentem identyczności między 94,12% a 100%!

Konkluzja

Konsekwencje wszystkiego, co właśnie wyjaśniliśmy, są jasne i natychmiastowe:
NIE MA PRZEKONYWUJĄCEGO TESTU DO WYKRYCIA SARS-COV-2, ani testów przeciwciał ani testów antygenowych, ani RT-PCR.
Uwzględniliśmy te oparte na rzekomym genie kodowym dla białka S1 lub kolca. A to oznacza, że WSZYSTKIE LICZBY PRZYPADKÓW:

  • ZAKAŻONYCH,
  • CHORYCH
  • BEZOBJAWOWYCH
  • ZMARŁYCH Z POWODU COVID-19

NIE MAJĄ PODSTAWY NAUKOWEJ I WSZYSTKIE WYNIKI TESTÓW POZYTYWNYCH SĄ FAŁSZYWNYMI POZYTYWAMI, o czym należy natychmiast poinformować osoby dotknięte chorobą a osoby odpowiedzialne powinny zostać pociągnięte do odpowiedzialności!

Kończymy dodając, że nawet sama WHO tak naprawdę nie wierzy w te testy. Wystarczy przeczytać dokument opublikowany 11 września bieżącego roku jako przewodnik laboratoryjny dla SARS-CoV-2 zatytułowany Diagnostic tests for SARS-CoV-2 – jest dostępny pod adresem https://apps.who.int/iris/rest/bitstreams/1302661/
retrieve – dosłownie stwierdza na stronie 5:

„Gdy tylko jest to możliwe, podejrzenie aktywnej infekcji należy zbadać za pomocą testu amplifikacji kwasu nukleinowego (NAAT), takiego jak RT-PCR. Testy NAAT powinny być ukierunkowane na genom SARS-CoV-2, ale ponieważ nie jest znana globalna cyrkulacja SARS-CoV-1, sekwencja Sarbecovirus (przypuszczalnie obejmuje co najmniej pięć ludzkich i zwierzęcych koronawirusów, w tym SARS-CoV-1 i SARS-Cov- 2) jest również rozsądnym celem”.

Oznacza to, że WHO zgadza się na użycie sekwencji niespecyficznych do wykrywania SARS-CoV-2. To nie wszystko, ponieważ w podręczniku stwierdza się później: 

“Optymalna diagnoza składa się z testu NAAT z co najmniej dwoma niezależnymi od genomu celami SARS-CoV-2; jednak w obszarach, w których transmisja jest szeroko rozpowszechniona, można zastosować prosty algorytm pojedynczego celu”.

Podręcznik WHO stwierdza: 

„Jeden lub więcej negatywnych wyników niekoniecznie wyklucza zakażenie SARS-CoV-2. Istnieje wiele czynników, które mogą spowodować negatywny wynik u zakażonej osoby, w tym zła jakość próbki, późne pobranie próbki, niewłaściwa obsługa lub przyczyny techniczne nieodłącznie związane z testem, takie jak mutacja wirusa lub zahamowanie reakcji PCR”.

Na co czekają sędziowie, by podjąć działania z własnej inicjatywy?

Jezus Garcia Blanca

Uwaga: autor publicznie dziękuje Juanowi Pedro Aparicio Alcarazowi za jego cierpliwą i skrupulatną współpracę w poszukiwaniu artykułów naukowych oraz za żmudną pracę z BLAST-em.

źródła:
https://www.dsalud.com/…/la-estafa-se-constata-la-pcr…/
https://philosophers-stone.info/…/The-scam-has-been…
https://www.fluoridefreepeel.ca/…/FOI-responses-re…

za : stolikwolności.pl

Ostatnie wpisy

Kategorie

KOLEJNE DOWODY POTWIERDZAJĄ : TESTY P/C/R NIE WYKRYWAJĄ 🦠 C0¥ID, KTÓREGO NIGDY NIE WYIZOLOWANO

19 lutego 2021 / Możliwość komentowania KOLEJNE DOWODY POTWIERDZAJĄ : TESTY P/C/R NIE WYKRYWAJĄ 🦠 C0¥ID, KTÓREGO NIGDY NIE WYIZOLOWANO

Coronavirus 229E.

Artykuł źródłowy: Dorothy Hamre i John Procknow. A new virus isolated from the human respiratory Tract. Proceedings of the Society

Koronawirus OC43.

Artykuł źródłowy: Paul Lee. Molecular epidemiology of human coronavirus OC43 in Hong Kong. Thesis for the Department of Microbiology, University

Koronawirus SARS-CoV.

Artykuł źródłowy: J. S. M. Peiris and others. Coronavirus as a possible cause of SARS. Lancet 361: 1319-25, April 2003.

Koronawirus NL63.

Artykuł źródłowy: Lia van der Hock and others. Identification of a new human coronavirus. Nature Medicine, 10, 4 April 2004.

Koronawirus HKU1.

Artykuł źródłowy: Patrick C. Y. Woo and others. Characterisation and Complete Genome Sequence of a Novel Coronavirus, Coronavirus HKU1, from

Koronawirus MERS-CoV.

Artykuł źródłowy: Ali Moh Zaki and others. Isolation of a Novel Coronavirus from a Man with Pneumonia in Saudi Arabia.

SEKWENCJE TZW. SARS-COV-2 ZNAJDUJĄ SIĘ ZARÓWNO U LUDZI, JAK I W LICZNYCH MIKROORGANIZMACH!

Przyjrzyjmy się szczegółowo procedurze na przykładzie inicjatorów protokołu francuskiego. Na stronie BLAST wybraliśmy Mikroby do przeszukania baz danych genomów drobnoustrojów

Może Ci się spodobać

EDWARD SNOWDEN: EPIDEMIA PRZEJDZIE, INWIGILACJA PRZY POMOCY SZTUCZNEJ INTELIGENCJI ZOSTANIE. 30 marca 2020

  • Ostatnie wpisy
  • Kategorie
  • KOLEJNE DOWODY POTWIERDZAJĄ : TESTY P/C/R NIE WYKRYWAJĄ 🦠 C0¥ID, KTÓREGO NIGDY NIE WYIZOLOWANO
  • Coronavirus 229E.
  • Koronawirus OC43.
  • Koronawirus SARS-CoV.
  • Koronawirus NL63.
  • Koronawirus HKU1.
  • Koronawirus MERS-CoV.
  • SEKWENCJE TZW. SARS-COV-2 ZNAJDUJĄ SIĘ ZARÓWNO U LUDZI, JAK I W LICZNYCH MIKROORGANIZMACH!
  • Może Ci się spodobać